molecular B(io)LOG(y)

This may be not the oldest model of DNA but is pretty old and has an interesting history. The display at the left says:

This model of the DNA double helix is a reproduction of a model which was presented in the US Science Exhibit at the Seattle Worlds Fair “Century 21” in 1962. Max Delbrück, one of the founders of Institute of Genetics, obtained the model in summer 1962. For over four decades the replica was located in the lecture hall at the sixth floor of the old institute’s building. In 2006 it was restored and moved to the new building. The base sequence reads from top to bottom

CTCCACTGTGTCGGGGTCAA

Actually, the official name of the institute is "Institute for Genetics", but maybe it has been named differently in the beginning.
For those who are unaware: Max Delbrück is not only the founder of the Institute for Genetics of the University of Cologne but one of the fathers of molecular biology (for a detailed biography see E.P.Fischer's article in Genetics). His 1935 paper Über die Natur der Genmutation und der Genstruktur co-authored by N.W. Timoféef-Ressovsky and K.G. Zimmer founded the idea that the gene is a physical entity accessible to experimental investigation. Fischer summerizes these ideas:

After presenting quantitative results of the effects of ionizing radiation on mutation frequency, in a separate chapter Max worked out a quantum mechanical model of the gene, calling it an “Atomverband”—a collection of atoms—thereby connecting genetics with physics and chemistry and opening the abstract gene for a concrete analysis using the exact sciences.

In addition, Delbrück was one of the first who used phages to study the molecular mechanisms underlying genetics. E.g., togeter with Salvador Luria he demonstrated that bacterial resistance to virus infection is caused by random mutation and not adaptive change. Beside his other work in molecular biology this famous Luria-Delbrück experiment was the reason that Delbrück obtained the Nobel Prize in Physiology or Medicine in 1969. Actually, in one of the experiments in the practical course for freshmen the institute T4 phages to transduce E. coli, just like it was done in the Cold Spring Harbor Phage Courses that Delbrück initiated and from where he transferred the phage technology to the University

The English text doesn't mention that Delbrück purchased the model as "Percentage for Art" and I've been told that he had some problems to get the permission from the university administration to do that because usually artists are assigned to develop some decorative art for this purpose. Unfortunately, its original location in the lecture hall on the sixth floor of the old building of the institute was not accessible to the public. And most of the PhD students including myself who joined seminars in this room and had their thesis defence in there may not have known the history of the DNA model. Thus, it was a good idea to place it in the entrance hall of the new building where it is located in the middle of a small exhibit which displays photos and documents of Delbrück's life and work. The exhibition is open to the public during working time.

BTW, the sequence displayed by the model can not be a natural sequence because sequencing methods only became available in the seventies.

After 46 years, the model is in a reasonable state although sixties plastic seems to be not as robust as the material one would use today. In the figure legend the symbol for oxygen is missing (see picture above) and one can find a single strand break (see circles in the figure below).


Luckily, the ceiling in the new location is lower then in the old lecture hall. Thus, surplus atoms and chemical bonds can be used to restore the model in the future. Hopefully it will survive another fourty years.

Edit: I've been told that the institute paid 50,000 DM for the model in 1962. Based on the development of the purchasing power of the German currency and the Euro this would equal a prize of about 80,000 € today and thus 4,000 €/bp.