molecular B(io)LOG(y)

Read more!

Read more!

Overwhelmingevidence the training camp of ID-creationists claims that

Overwhelming Evidence is a site where high school and college students (though non-students will be permitted, this is a site geared towards and created for students) can network and communicate their views on intelligent design and evolution.

and

This site is meant to encourage students to explore the facts, report the facts, and debate the facts.

So here are the facts:
Denyse O'Leary partraying herself as

Toronto-based Canadian journalist (b 1950)

has taken over UD. Besides her posts there is nearly nothing happening over at OE. Luckily OE runs a user point system that credits activities of posters and commenters. Based on the records currently displayed over, older data I stored last year and additional data available from the Internet archive wayback machine it becomes evident that D’OL accelerated her posting substantially since 2007.



Compared with D’OL the other top bloggers at UD can be justified as flat liners. However, to be fair one should keep in mind that D’OL cross-posted most of her stuff on one of her other blogs.

As of June 30, 2008 D’OL has 2266 user points which equals 42% of all user points ever credited at OE.


Indeed, a clear indication of the youth networking and communicating their views on intelligent design and evolution. Wait until little Denyse has grown up.

I must admit though that I do not understand the OE user point system. As long as I watched OE the D’OL’s points incremented daily by multiples of 10 irrespective of the fact that hardly anybody commented at her blog. Posts of other contributors usually indicate 1 or 2 credit points if somebody commented on the issue. Actually they really do not seem to care if readers would find the system inconsistent:
WMAD aka William Dembski aka the Newton of information theory has only a single post on his OE blog: After a promising start on December 12, 2006 which gained him 1 point he fell down to -15 user points at the latest from February 18, 2007 on.


Ridiculous.

Read more!

I didn't think about this for a long time. But a recent post in Spiegel einestages brought back the memory: I witnessed Bob Dylan's first concert in Germany in the Westfalenhalle in Dortmund 1978 and his Nuremberg Concert a few days later. Guess who else visited the concert: Günther Netzer! One of Germany's best soccer players ever who appears on TV daily during the Euro 2008. Obviously he had a better place much closer to the stage but I guess I was more enthusiastic and had more fun.

Read more!

EDIT (June 21st 2008) :

Did D'OL finally give up Overwhelming evidence?

Seemingly no since her user points increased to 2216 today.

Read more!

This may be not the oldest model of DNA but is pretty old and has an interesting history. The display at the left says:

This model of the DNA double helix is a reproduction of a model which was presented in the US Science Exhibit at the Seattle Worlds Fair “Century 21” in 1962. Max Delbrück, one of the founders of Institute of Genetics, obtained the model in summer 1962. For over four decades the replica was located in the lecture hall at the sixth floor of the old institute’s building. In 2006 it was restored and moved to the new building. The base sequence reads from top to bottom

CTCCACTGTGTCGGGGTCAA

Actually, the official name of the institute is "Institute for Genetics", but maybe it has been named differently in the beginning.
For those who are unaware: Max Delbrück is not only the founder of the Institute for Genetics of the University of Cologne but one of the fathers of molecular biology (for a detailed biography see E.P.Fischer's article in Genetics). His 1935 paper Über die Natur der Genmutation und der Genstruktur co-authored by N.W. Timoféef-Ressovsky and K.G. Zimmer founded the idea that the gene is a physical entity accessible to experimental investigation. Fischer summerizes these ideas:

After presenting quantitative results of the effects of ionizing radiation on mutation frequency, in a separate chapter Max worked out a quantum mechanical model of the gene, calling it an “Atomverband”—a collection of atoms—thereby connecting genetics with physics and chemistry and opening the abstract gene for a concrete analysis using the exact sciences.

In addition, Delbrück was one of the first who used phages to study the molecular mechanisms underlying genetics. E.g., togeter with Salvador Luria he demonstrated that bacterial resistance to virus infection is caused by random mutation and not adaptive change. Beside his other work in molecular biology this famous Luria-Delbrück experiment was the reason that Delbrück obtained the Nobel Prize in Physiology or Medicine in 1969. Actually, in one of the experiments in the practical course for freshmen the institute T4 phages to transduce E. coli, just like it was done in the Cold Spring Harbor Phage Courses that Delbrück initiated and from where he transferred the phage technology to the University

The English text doesn't mention that Delbrück purchased the model as "Percentage for Art" and I've been told that he had some problems to get the permission from the university administration to do that because usually artists are assigned to develop some decorative art for this purpose. Unfortunately, its original location in the lecture hall on the sixth floor of the old building of the institute was not accessible to the public. And most of the PhD students including myself who joined seminars in this room and had their thesis defence in there may not have known the history of the DNA model. Thus, it was a good idea to place it in the entrance hall of the new building where it is located in the middle of a small exhibit which displays photos and documents of Delbrück's life and work. The exhibition is open to the public during working time.

BTW, the sequence displayed by the model can not be a natural sequence because sequencing methods only became available in the seventies.

After 46 years, the model is in a reasonable state although sixties plastic seems to be not as robust as the material one would use today. In the figure legend the symbol for oxygen is missing (see picture above) and one can find a single strand break (see circles in the figure below).


Luckily, the ceiling in the new location is lower then in the old lecture hall. Thus, surplus atoms and chemical bonds can be used to restore the model in the future. Hopefully it will survive another fourty years.

Edit: I've been told that the institute paid 50,000 DM for the model in 1962. Based on the development of the purchasing power of the German currency and the Euro this would equal a prize of about 80,000 € today and thus 4,000 €/bp.

Read more!

As suggested by Clastric Detritus I've run the aof my publications through TagCrowd's tag cloud generator:

Unfortunately, there are no links to the papers and you will have to us the link at the upper right corner to find my publication record.

Read more!